rt pcr (Bio-Rad)
Bio-Rad is a verified supplier 
Bio-Rad manufactures this product 
99
Structured Review
Bio-Rad
rt pcr
Rt Pcr, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 36371 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rt-lab+software/Image+Lab+Software/pm30389502-110-5-12
Average 99 stars, based on 36371 article reviews
Rt Pcr, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 36371 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rt-lab+software/Image+Lab+Software/pm30389502-110-5-12
Average 99 stars, based on 36371 article reviews
rt pcr - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
Cloning:Article Title: Unprocessed genomic uracil as a source of DNA replication stress in cancer cells. Article Snippet: U2OS UNG2 KO Clone 1 Generated in this study N/A U2OS UNG2 KO Clone 2 Generated in this study N/A U2OS+pINDUCER20 Generated in this study N/A U2OS+WT UNG2-HA (Dox inducible) Generated in this study N/A HEK293T ATCC CRL-11268 .. Calu-1 MGH CMT N/A RPE-1 ATCC CRL-4000 MGH 134.1 Hata Lab N/A MGH 707.1 Hata Lab N/A MGH 143-3B Hata Lab N/A Oligonucleotides Primers for cloning This study See STAR Methods below siRNA sequences This study See STAR Methods below Primers for RT-qPCR This study See STAR Methods below Recombinant DNA UNG (NM_080911) Human Tagged ORF Clone Origene RC222868 pINDUCER20 Meerbrey et al.65 Addgene 44012 pINDUCER20+WT UNG2-HA Generated in this study N/A Software and algorithms GraphPad Prism 6 GraphPad Software, Inc https://www.graphpad.com/ NIS Elements Viewer Nikon https://www.microscope.healthcare. nikon.com/products/software/ Quantitative RT-PCR:Article Title: Unprocessed genomic uracil as a source of DNA replication stress in cancer cells. Article Snippet: U2OS UNG2 KO Clone 1 Generated in this study N/A U2OS UNG2 KO Clone 2 Generated in this study N/A U2OS+pINDUCER20 Generated in this study N/A U2OS+WT UNG2-HA (Dox inducible) Generated in this study N/A HEK293T ATCC CRL-11268 .. Calu-1 MGH CMT N/A RPE-1 ATCC CRL-4000 MGH 134.1 Hata Lab N/A MGH 707.1 Hata Lab N/A MGH 143-3B Hata Lab N/A Oligonucleotides Primers for cloning This study See STAR Methods below siRNA sequences This study See STAR Methods below Primers for RT-qPCR This study See STAR Methods below Recombinant DNA UNG (NM_080911) Human Tagged ORF Clone Origene RC222868 pINDUCER20 Meerbrey et al.65 Addgene 44012 pINDUCER20+WT UNG2-HA Generated in this study N/A Software and algorithms GraphPad Prism 6 GraphPad Software, Inc https://www.graphpad.com/ NIS Elements Viewer Nikon https://www.microscope.healthcare. nikon.com/products/software/ Article Title: Multi-dimensional metabolomic remodeling under diverse muscle atrophic stimuli in vivo. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER TSKgel Amide-80 (3.0 μm, 2.0 mm × 15 cm TOSOH Corporation Cat# 0021865 G266 DNA Damage Detection Kit - γH2AX - Red Dojindo Molecular Technologies Cat# 340-09431 HEPES Nacalai Tesque Cat# 02443-34 Trichloroacetic acid Nacalai Tesque Cat# 06275-24 L-Methionine sulfome Thermo Fisher Cat# A17027 Takara Taq Takara Cat# R001A Takara Ex Taq Takara Cat# RR001A Agarose for ≧1kbp fragment (Fine Powder) Nacalai Tesque Cat# 02468-95 100 bp DNA ladder One Nacalai Tesque Cat# 07908-75 6x Loading Dye Toyobo Cat# RE-DYE Ethidium Bromide Solution Nacalai Tesque Cat# 14631-94 Sodium Chloride Nacalai Tesque Cat# 31320-05 Bacto TM Peptone DIFCO Cat# 0118-17-0 Extract Yeast Dried Nacalai Tesque Cat# 15838-45 Bacto TM Agar BD Cat# 214010 Competent Quick DH5α Toyobo Cat# DNA-913 Ampicillin Sodium Salt Nacalai Tesque Cat# 02739-74 KOD-Plus-Neo Toyobo Cat# KOD-401 QIAGEN Plasmid Midi kit QIAGEN Cat# 12145 Calf intestine alkarine phosphatase Takara Cat# 2250A QIAEX II Gel Extraction Kit QIAGEN Cat# 20021 DNA Ligation Kit Ver.2.1 Takara Cat# 6022 Venoject II Terumo Cat# VP-DK051K Isoflurane Viatris – Domitor Nippon Zenyaku Kogyo – Midazolam Sandoz – Vetorphale Meiji Seika Pharma – Antisedan Nippon Zenyaku Kogyo – Deposited data Metabolomics data (Skeletal muscle, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003721; Project ID: PR002310 Metabolomics data (plasma, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003722; Project ID: PR002311 Metabolomics data (Skeletal muscle, Cancer cachexia and starvation, C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003723; Project ID: PR002312 Metabolomics data (Skeletal muscle, immobilization, mFoxO1,3,4 flox/flox and mFoxO1,3,4 − /− ) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003724; Project ID: PR002313 Experimental models: Cell lines LLC cells: LL/2 (LLC1) ATCC CRL-1642 Primary myoblast This paper N/A C2C12 myoblasts Riken Cell Bank RCB0987 C2C12 myoblasts (Western blot analysis for SUnSET analysis and MG-132 experiment) ATCC CRL-1772 HEK293T cells Oyabu et al. 29 N/A Experimental models: Organisms/strains Mouse: C57BL/6J CLEA – Mouse: HSA-FOXO1-Tg Kamei Lab N/A Mouse: HSA-Cre FoxO1,3,4 flox/flox Kamei Lab N/A Mouse: HSA-DN-FOXO1-Tg Yamazaki et al. 42 N/A (Continued on next page) Cell Reports 44, 116097, August 26, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primers for genotyping This paper Table S1 Primer for RT-qPCR This paper Table S2 MISSION siRNA Universal Negative Control #1 Sigma-Aldrich Cat# SIC001 MISSION siAmd2_1 Sigma-Aldrich Cat# SASI_Mm02_00311615 MISSION siAmd2_2 Sigma-Aldrich Cat# SASI_Mm01_00156378 Recombinant DNA pCAG-FOXO1(3A) Oyabu et al. 29 N/A pCMX-GFP Oyabu et al. 29 N/A pGL3-Odc1 promoter-luciferase This paper N/A phRL-TK Promega Cat# E2241 Software and Article Title: Alternative mRNA splicing events and regulators in epidermal differentiation. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Halt Protease and Phosphatase Inhibitor Cocktail Thermo Scientific Cat# 78440 Lipofectamine RNAiMAX Transfection Reagent Invitrogen Cat# 13778030 Attractene Transfection Reagent Qiagen Cat# 301005 Agarose Fisher BioReagent Cat# BP160-500 Human TNFa Recombinant Protein Fisher Scientific Cat# 210-TA-005 alamarBlue Cell Viability Reagent Invitrogen Cat# DAL1025 Tissue-Tek O.C.T. .. Compound Sakura Cat# 4583 Prostratin, PKC activator abcam Cat# ab120880 Critical commercial assays RNeasy Plus Mini Kit Qiagen Cat# 74136 iScript Reverse Transcription Supermix for RT-qPCR Bio-Rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-Rad Cat# 1725124 Nuclear Extract Kit Active Motif Cat# 40010 TransAM NF-kB p65 Transcription Factor ELISA Kit Active Motif Cat# 40097 Deposited data RNA-seq data This paper GEO: GSE201094 Experimental models: Cell lines Human primary keratinocytes This Paper N/A Experimental models: Organisms/strains Human Dermis New York Firefighters Skin Bank N/A Oligonucleotides DsiRNA (MAP3K7 long) Forward Integrated DNA Technologies 50- CGUAAAACUGCUUCAUUUGGC AACA-30 DsiRNA (MAP3K7 long) Reverse Integrated DNA Technologies 50- UGGCAUUUUGACGAAGUAAAC CGUUGU-30 DsiRNA (MAP3K7 short) Forward Integrated DNA Technologies 50- CAAAGCAACAGAGUGAAUCUG GACGUU-30 DsiRNA (MAP3K7 short) Reverse Integrated DNA Technologies 50- GUUUCGUUGUCUCACUUAGAC CUGCAA-30 FUS siRNA-1 Thermo Fisher S5401 FUS siRNA-2 Thermo Fisher S533595 siRNA (negative control) Thermo Fisher Cat# 4390843 Primers for RT-PCR and qRT-PCR, see Table S6 This paper N/A Recombinant DNA pcDNA3.1-C-(k)DYK-MAP3K7 long Genescript Cat# OHu21832 pcDNA3.1-C-(k)DYK-MAP3K7 short Genescript Cat# OHu14588 Software and algorithms Prism 9 GraphPad software www.graphpad.com Recombinant:Article Title: Unprocessed genomic uracil as a source of DNA replication stress in cancer cells. Article Snippet: U2OS UNG2 KO Clone 1 Generated in this study N/A U2OS UNG2 KO Clone 2 Generated in this study N/A U2OS+pINDUCER20 Generated in this study N/A U2OS+WT UNG2-HA (Dox inducible) Generated in this study N/A HEK293T ATCC CRL-11268 .. Calu-1 MGH CMT N/A RPE-1 ATCC CRL-4000 MGH 134.1 Hata Lab N/A MGH 707.1 Hata Lab N/A MGH 143-3B Hata Lab N/A Oligonucleotides Primers for cloning This study See STAR Methods below siRNA sequences This study See STAR Methods below Primers for RT-qPCR This study See STAR Methods below Recombinant DNA UNG (NM_080911) Human Tagged ORF Clone Origene RC222868 pINDUCER20 Meerbrey et al.65 Addgene 44012 pINDUCER20+WT UNG2-HA Generated in this study N/A Software and algorithms GraphPad Prism 6 GraphPad Software, Inc https://www.graphpad.com/ NIS Elements Viewer Nikon https://www.microscope.healthcare. nikon.com/products/software/ Article Title: Multi-dimensional metabolomic remodeling under diverse muscle atrophic stimuli in vivo. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER TSKgel Amide-80 (3.0 μm, 2.0 mm × 15 cm TOSOH Corporation Cat# 0021865 G266 DNA Damage Detection Kit - γH2AX - Red Dojindo Molecular Technologies Cat# 340-09431 HEPES Nacalai Tesque Cat# 02443-34 Trichloroacetic acid Nacalai Tesque Cat# 06275-24 L-Methionine sulfome Thermo Fisher Cat# A17027 Takara Taq Takara Cat# R001A Takara Ex Taq Takara Cat# RR001A Agarose for ≧1kbp fragment (Fine Powder) Nacalai Tesque Cat# 02468-95 100 bp DNA ladder One Nacalai Tesque Cat# 07908-75 6x Loading Dye Toyobo Cat# RE-DYE Ethidium Bromide Solution Nacalai Tesque Cat# 14631-94 Sodium Chloride Nacalai Tesque Cat# 31320-05 Bacto TM Peptone DIFCO Cat# 0118-17-0 Extract Yeast Dried Nacalai Tesque Cat# 15838-45 Bacto TM Agar BD Cat# 214010 Competent Quick DH5α Toyobo Cat# DNA-913 Ampicillin Sodium Salt Nacalai Tesque Cat# 02739-74 KOD-Plus-Neo Toyobo Cat# KOD-401 QIAGEN Plasmid Midi kit QIAGEN Cat# 12145 Calf intestine alkarine phosphatase Takara Cat# 2250A QIAEX II Gel Extraction Kit QIAGEN Cat# 20021 DNA Ligation Kit Ver.2.1 Takara Cat# 6022 Venoject II Terumo Cat# VP-DK051K Isoflurane Viatris – Domitor Nippon Zenyaku Kogyo – Midazolam Sandoz – Vetorphale Meiji Seika Pharma – Antisedan Nippon Zenyaku Kogyo – Deposited data Metabolomics data (Skeletal muscle, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003721; Project ID: PR002310 Metabolomics data (plasma, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003722; Project ID: PR002311 Metabolomics data (Skeletal muscle, Cancer cachexia and starvation, C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003723; Project ID: PR002312 Metabolomics data (Skeletal muscle, immobilization, mFoxO1,3,4 flox/flox and mFoxO1,3,4 − /− ) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003724; Project ID: PR002313 Experimental models: Cell lines LLC cells: LL/2 (LLC1) ATCC CRL-1642 Primary myoblast This paper N/A C2C12 myoblasts Riken Cell Bank RCB0987 C2C12 myoblasts (Western blot analysis for SUnSET analysis and MG-132 experiment) ATCC CRL-1772 HEK293T cells Oyabu et al. 29 N/A Experimental models: Organisms/strains Mouse: C57BL/6J CLEA – Mouse: HSA-FOXO1-Tg Kamei Lab N/A Mouse: HSA-Cre FoxO1,3,4 flox/flox Kamei Lab N/A Mouse: HSA-DN-FOXO1-Tg Yamazaki et al. 42 N/A (Continued on next page) Cell Reports 44, 116097, August 26, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primers for genotyping This paper Table S1 Primer for RT-qPCR This paper Table S2 MISSION siRNA Universal Negative Control #1 Sigma-Aldrich Cat# SIC001 MISSION siAmd2_1 Sigma-Aldrich Cat# SASI_Mm02_00311615 MISSION siAmd2_2 Sigma-Aldrich Cat# SASI_Mm01_00156378 Recombinant DNA pCAG-FOXO1(3A) Oyabu et al. 29 N/A pCMX-GFP Oyabu et al. 29 N/A pGL3-Odc1 promoter-luciferase This paper N/A phRL-TK Promega Cat# E2241 Software and Article Title: Alternative mRNA splicing events and regulators in epidermal differentiation. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Halt Protease and Phosphatase Inhibitor Cocktail Thermo Scientific Cat# 78440 Lipofectamine RNAiMAX Transfection Reagent Invitrogen Cat# 13778030 Attractene Transfection Reagent Qiagen Cat# 301005 Agarose Fisher BioReagent Cat# BP160-500 Human TNFa Recombinant Protein Fisher Scientific Cat# 210-TA-005 alamarBlue Cell Viability Reagent Invitrogen Cat# DAL1025 Tissue-Tek O.C.T. .. Compound Sakura Cat# 4583 Prostratin, PKC activator abcam Cat# ab120880 Critical commercial assays RNeasy Plus Mini Kit Qiagen Cat# 74136 iScript Reverse Transcription Supermix for RT-qPCR Bio-Rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-Rad Cat# 1725124 Nuclear Extract Kit Active Motif Cat# 40010 TransAM NF-kB p65 Transcription Factor ELISA Kit Active Motif Cat# 40097 Deposited data RNA-seq data This paper GEO: GSE201094 Experimental models: Cell lines Human primary keratinocytes This Paper N/A Experimental models: Organisms/strains Human Dermis New York Firefighters Skin Bank N/A Oligonucleotides DsiRNA (MAP3K7 long) Forward Integrated DNA Technologies 50- CGUAAAACUGCUUCAUUUGGC AACA-30 DsiRNA (MAP3K7 long) Reverse Integrated DNA Technologies 50- UGGCAUUUUGACGAAGUAAAC CGUUGU-30 DsiRNA (MAP3K7 short) Forward Integrated DNA Technologies 50- CAAAGCAACAGAGUGAAUCUG GACGUU-30 DsiRNA (MAP3K7 short) Reverse Integrated DNA Technologies 50- GUUUCGUUGUCUCACUUAGAC CUGCAA-30 FUS siRNA-1 Thermo Fisher S5401 FUS siRNA-2 Thermo Fisher S533595 siRNA (negative control) Thermo Fisher Cat# 4390843 Primers for RT-PCR and qRT-PCR, see Table S6 This paper N/A Recombinant DNA pcDNA3.1-C-(k)DYK-MAP3K7 long Genescript Cat# OHu21832 pcDNA3.1-C-(k)DYK-MAP3K7 short Genescript Cat# OHu14588 Software and algorithms Prism 9 GraphPad software www.graphpad.com Generated:Article Title: Unprocessed genomic uracil as a source of DNA replication stress in cancer cells. Article Snippet: U2OS UNG2 KO Clone 1 Generated in this study N/A U2OS UNG2 KO Clone 2 Generated in this study N/A U2OS+pINDUCER20 Generated in this study N/A U2OS+WT UNG2-HA (Dox inducible) Generated in this study N/A HEK293T ATCC CRL-11268 .. Calu-1 MGH CMT N/A RPE-1 ATCC CRL-4000 MGH 134.1 Hata Lab N/A MGH 707.1 Hata Lab N/A MGH 143-3B Hata Lab N/A Oligonucleotides Primers for cloning This study See STAR Methods below siRNA sequences This study See STAR Methods below Primers for RT-qPCR This study See STAR Methods below Recombinant DNA UNG (NM_080911) Human Tagged ORF Clone Origene RC222868 pINDUCER20 Meerbrey et al.65 Addgene 44012 pINDUCER20+WT UNG2-HA Generated in this study N/A Software and algorithms GraphPad Prism 6 GraphPad Software, Inc https://www.graphpad.com/ NIS Elements Viewer Nikon https://www.microscope.healthcare. nikon.com/products/software/ Software:Article Title: Unprocessed genomic uracil as a source of DNA replication stress in cancer cells. Article Snippet: U2OS UNG2 KO Clone 1 Generated in this study N/A U2OS UNG2 KO Clone 2 Generated in this study N/A U2OS+pINDUCER20 Generated in this study N/A U2OS+WT UNG2-HA (Dox inducible) Generated in this study N/A HEK293T ATCC CRL-11268 .. Calu-1 MGH CMT N/A RPE-1 ATCC CRL-4000 MGH 134.1 Hata Lab N/A MGH 707.1 Hata Lab N/A MGH 143-3B Hata Lab N/A Oligonucleotides Primers for cloning This study See STAR Methods below siRNA sequences This study See STAR Methods below Primers for RT-qPCR This study See STAR Methods below Recombinant DNA UNG (NM_080911) Human Tagged ORF Clone Origene RC222868 pINDUCER20 Meerbrey et al.65 Addgene 44012 pINDUCER20+WT UNG2-HA Generated in this study N/A Software and algorithms GraphPad Prism 6 GraphPad Software, Inc https://www.graphpad.com/ NIS Elements Viewer Nikon https://www.microscope.healthcare. nikon.com/products/software/ Article Title: Cells in the Polyaneuploid Cancer Cell State Are Prometastatic Article Snippet: .. Membranes were imaged using the ChemiDoc XRS+ imaging system (Bio-Rad), and Article Title: Multi-dimensional metabolomic remodeling under diverse muscle atrophic stimuli in vivo. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER TSKgel Amide-80 (3.0 μm, 2.0 mm × 15 cm TOSOH Corporation Cat# 0021865 G266 DNA Damage Detection Kit - γH2AX - Red Dojindo Molecular Technologies Cat# 340-09431 HEPES Nacalai Tesque Cat# 02443-34 Trichloroacetic acid Nacalai Tesque Cat# 06275-24 L-Methionine sulfome Thermo Fisher Cat# A17027 Takara Taq Takara Cat# R001A Takara Ex Taq Takara Cat# RR001A Agarose for ≧1kbp fragment (Fine Powder) Nacalai Tesque Cat# 02468-95 100 bp DNA ladder One Nacalai Tesque Cat# 07908-75 6x Loading Dye Toyobo Cat# RE-DYE Ethidium Bromide Solution Nacalai Tesque Cat# 14631-94 Sodium Chloride Nacalai Tesque Cat# 31320-05 Bacto TM Peptone DIFCO Cat# 0118-17-0 Extract Yeast Dried Nacalai Tesque Cat# 15838-45 Bacto TM Agar BD Cat# 214010 Competent Quick DH5α Toyobo Cat# DNA-913 Ampicillin Sodium Salt Nacalai Tesque Cat# 02739-74 KOD-Plus-Neo Toyobo Cat# KOD-401 QIAGEN Plasmid Midi kit QIAGEN Cat# 12145 Calf intestine alkarine phosphatase Takara Cat# 2250A QIAEX II Gel Extraction Kit QIAGEN Cat# 20021 DNA Ligation Kit Ver.2.1 Takara Cat# 6022 Venoject II Terumo Cat# VP-DK051K Isoflurane Viatris – Domitor Nippon Zenyaku Kogyo – Midazolam Sandoz – Vetorphale Meiji Seika Pharma – Antisedan Nippon Zenyaku Kogyo – Deposited data Metabolomics data (Skeletal muscle, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003721; Project ID: PR002310 Metabolomics data (plasma, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003722; Project ID: PR002311 Metabolomics data (Skeletal muscle, Cancer cachexia and starvation, C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003723; Project ID: PR002312 Metabolomics data (Skeletal muscle, immobilization, mFoxO1,3,4 flox/flox and mFoxO1,3,4 − /− ) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003724; Project ID: PR002313 Experimental models: Cell lines LLC cells: LL/2 (LLC1) ATCC CRL-1642 Primary myoblast This paper N/A C2C12 myoblasts Riken Cell Bank RCB0987 C2C12 myoblasts (Western blot analysis for SUnSET analysis and MG-132 experiment) ATCC CRL-1772 HEK293T cells Oyabu et al. 29 N/A Experimental models: Organisms/strains Mouse: C57BL/6J CLEA – Mouse: HSA-FOXO1-Tg Kamei Lab N/A Mouse: HSA-Cre FoxO1,3,4 flox/flox Kamei Lab N/A Mouse: HSA-DN-FOXO1-Tg Yamazaki et al. 42 N/A (Continued on next page) Cell Reports 44, 116097, August 26, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primers for genotyping This paper Table S1 Primer for RT-qPCR This paper Table S2 MISSION siRNA Universal Negative Control #1 Sigma-Aldrich Cat# SIC001 MISSION siAmd2_1 Sigma-Aldrich Cat# SASI_Mm02_00311615 MISSION siAmd2_2 Sigma-Aldrich Cat# SASI_Mm01_00156378 Recombinant DNA pCAG-FOXO1(3A) Oyabu et al. 29 N/A pCMX-GFP Oyabu et al. 29 N/A pGL3-Odc1 promoter-luciferase This paper N/A phRL-TK Promega Cat# E2241 Software and Article Title: Alternative mRNA splicing events and regulators in epidermal differentiation. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Halt Protease and Phosphatase Inhibitor Cocktail Thermo Scientific Cat# 78440 Lipofectamine RNAiMAX Transfection Reagent Invitrogen Cat# 13778030 Attractene Transfection Reagent Qiagen Cat# 301005 Agarose Fisher BioReagent Cat# BP160-500 Human TNFa Recombinant Protein Fisher Scientific Cat# 210-TA-005 alamarBlue Cell Viability Reagent Invitrogen Cat# DAL1025 Tissue-Tek O.C.T. .. Compound Sakura Cat# 4583 Prostratin, PKC activator abcam Cat# ab120880 Critical commercial assays RNeasy Plus Mini Kit Qiagen Cat# 74136 iScript Reverse Transcription Supermix for RT-qPCR Bio-Rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-Rad Cat# 1725124 Nuclear Extract Kit Active Motif Cat# 40010 TransAM NF-kB p65 Transcription Factor ELISA Kit Active Motif Cat# 40097 Deposited data RNA-seq data This paper GEO: GSE201094 Experimental models: Cell lines Human primary keratinocytes This Paper N/A Experimental models: Organisms/strains Human Dermis New York Firefighters Skin Bank N/A Oligonucleotides DsiRNA (MAP3K7 long) Forward Integrated DNA Technologies 50- CGUAAAACUGCUUCAUUUGGC AACA-30 DsiRNA (MAP3K7 long) Reverse Integrated DNA Technologies 50- UGGCAUUUUGACGAAGUAAAC CGUUGU-30 DsiRNA (MAP3K7 short) Forward Integrated DNA Technologies 50- CAAAGCAACAGAGUGAAUCUG GACGUU-30 DsiRNA (MAP3K7 short) Reverse Integrated DNA Technologies 50- GUUUCGUUGUCUCACUUAGAC CUGCAA-30 FUS siRNA-1 Thermo Fisher S5401 FUS siRNA-2 Thermo Fisher S533595 siRNA (negative control) Thermo Fisher Cat# 4390843 Primers for RT-PCR and qRT-PCR, see Table S6 This paper N/A Recombinant DNA pcDNA3.1-C-(k)DYK-MAP3K7 long Genescript Cat# OHu21832 pcDNA3.1-C-(k)DYK-MAP3K7 short Genescript Cat# OHu14588 Software and algorithms Prism 9 GraphPad software www.graphpad.com Article Title: NCOA1 is a gatekeeper of the sexually dimorphic thermogenic activity of white adipose tissue Article Snippet: Saturated membranes were incubated overnight with a 1:1000 dilution of a total OXPHOS human western blot antibody cocktail (Abcam, ab110413; RRID:AB_2629281) followed by incubation with HRP-conjugated anti-mouse immunoglobulins for 60 min. .. The chemiluminescence obtained after the addition of Clarity Western ECL substrate (Bio-Rad, Marnes-la-Coquette, France) was detected using a ChemiDoc MP imaging system (Bio-Rad) and quantified using other:Article Title: Microprotein SMIM26 drives oxidative metabolism via serine-responsive mitochondrial translation. Article Snippet: Article Microprotein SMIM26 drives oxidative metabolism via serine-responsive mitochondrial translation Graphical abstract Highlights • CRISPR screen identifies SMIM26 as linking the folate cycle to complex I biogenesis • SMIM26-SFXN1/2-mitoribosome triad promotes serinedependent mt-ND5 translation • SMIM26 loss disrupts mitochondrial tRNA modifications and impairs complex I assembly • SMIM26 is essential for embryonic development and tumor growth in folate-dependent AML Authors Jiemin Nah, Sreya Mahendran, Baptiste Kerouanton, ..., Gregory S. Ducker, David A. Stroud, Lena Ho Correspondence lena@ho-lab.org In brief Nah et al. identify the microprotein SMIM26 as a critical link between mitochondrial serine metabolism and complex I biogenesis.. By scaffolding serine transporters and mitoribosomes, SMIM26 enables nutrient-responsive translation of mt-ND5, revealing a metabolite-gated mechanism for respiratory complex assembly with implications for development and cancer metabolism.. Nah et al., 2025, Molecular Cell 85, 1–17 July 17, 2025 © 2025 Elsevier Inc. All rights are reserved, including those for text and data mining, AI training, and similar technologies. https://doi.org/10.1016/j.molcel.2025.05.033 ll Molecular Cell 85, 1, July 17, 2025 © 2025 Elsevier Inc. 1 All rights are reserved, including those for text and data mining, AI training, and similar technologies. Article Title: CDK4/6 inhibition reprograms the breast cancer immunopeptidome via Rb-dependent chromatin and transcriptomic remodeling. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER MCF7 ATCC Cat#HTB-22 MDAMB231 ATCC Cat#HTB-26 BT474 ATCC Cat#HTB-20 SKBR3 ATCC Cat#HTB-30 BT20 ATCC Cat#HTB-19 HCC70 ATCC Cat#CRL-2315 HEK293T In house stock N/A Oligonucleotides Oligonucleotides used for RT-qPCR have been added as a supplemenrtal document and can be found in Data S1 N/A N/A Recombinant DNA pCMV-HA-hRB-wt Narasimha et al. 61 obtained via Addgene Plasmid #58905 pCMV-HA-hRb-deltaCDK Narasimha et al. 61 obtained via Addgene Plasmid #58906 MISSION pLKO.1-puro shRNA against human RB1Plasmid Sigma-Aldrich ID:TRCN0000010419 MISSION pLKO.1-puro shRNA against human RB1Plasmid Sigma-Aldrich ID:TRCN0000040163 MISSION® pLKO.1-puro Non-Mammalian shRNA Control Plasmid DNA Sigma-Aldrich ID:SHC002 Software and algorithms DeepLC Bouwmeester et al. 103 https://compomics.github.io/ projects/DeepLC BamQuery Ruiz Cuevas et al. 41 https://github.com/lemieux-lab/BamQuery BD FACSDiva TM software (v.8.0.2) BD Biosciences https://www.bdbiosciences.com COMET version 2020.01 Eng et al. 103 https://uwpr.github.io/Comet/ DeepHLApan Wu et al. 56 https://github.com/jiujiezz/deephlapan DeepImmuno Li et al. 57 https://deepimmuno.research.cchmc.org/ Deeptools (v3.5.1) Ramirez et al. 104 https://github.com/deeptools/deepTools DESeq2 package Love et al. 105 https://bioconductor.org/packages/ devel/bioc/html/DESeq2.html AID EliSpot v8.0 software AID GmbH Germany https://www.aid-diagnostika.com/ Fgsea Korotkevich et al. 106 https://github.com/alserglab/fgsea FlowJo (v10) BD Biosciences https://www.flowjo.com/ Freebayes (v1.0.2) Garrison et al. 107 https://github.com/freebayes/freebayes ggplot2 Wickham et al. 108 https://ggplot2.tidyverse.org/ ggpubr Kassambara et al. 109 https://github.com/kassambara/ggpubr GSEA (v4.2.3) Mootha et al. 110 https://www.gsea-msigdb. Article Title: Zika virus remodels and hijacks IGF2BP2 ribonucleoprotein complex to promote viral replication organelle biogenesis Article Snippet: DOI: https://doi.org/10.7554/eLife.94347 25 of 38 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Sequence- based reagent IGF2BP2- HA- STOP- SpeI_R This paper IGF2BP2 cloning primers ACAA ACTA GTTT AGTA ATC AGGC ACGT CATA GGGG TAA CCCT TGCT GCGC TGTG AGGC GA Commercial assay or kit mMESSAGE mMACHINE T7 transcription Kit Thermo Fisher Cat#: AM1344 Commercial assay or kit Invitrogen SuperScript IV VILO Master Mix RT kit Thermo Fisher Cat#: 11756050 RT- qPCR assays Commercial assay or kit Applied Biosystems SyBr Green Master mix Thermo Fisher Cat#: A25918 RT- qPCR assays Commercial assay or kit ViewRNA ISH Cell Assay kit Thermo Fisher Cat#: QVC0001 Cat#: QVC0508 Cat#: QVC0509 Cat#: QG0507 Cat#: QVC0700 Cat#: VF4- 20142 Detection of ZIKV H/PF/2013 RNA in FISH experiments Commercial assay or kit Monoclonal Anti- HA- Agarose antibody MilliporeSigma Cat#: A2095 Commercial assay or kit Trizol- LS Thermo Fisher Cat#: 10296010 Chemical compound, drug NITD- 008 Tocris Small Molecules Cat#: 6045/1 Software, algorithm Prism 10 GraphPad RRID:SCR_002798 Software, algorithm MaxQuant software v.1.6.17 MaxQuant RRID: SCR_014485 Software, algorithm Perseus software v.1.6.15 MaxQuant RRID: SCR_015753 Software, algorithm MO.Affinity Analysis software v.2.1.3 NanoTemper Technologies GmbH Software, Imaging:Article Title: Cells in the Polyaneuploid Cancer Cell State Are Prometastatic Article Snippet: .. Membranes were imaged using the ChemiDoc XRS+ imaging system (Bio-Rad), and Article Title: Multi-dimensional metabolomic remodeling under diverse muscle atrophic stimuli in vivo. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER TSKgel Amide-80 (3.0 μm, 2.0 mm × 15 cm TOSOH Corporation Cat# 0021865 G266 DNA Damage Detection Kit - γH2AX - Red Dojindo Molecular Technologies Cat# 340-09431 HEPES Nacalai Tesque Cat# 02443-34 Trichloroacetic acid Nacalai Tesque Cat# 06275-24 L-Methionine sulfome Thermo Fisher Cat# A17027 Takara Taq Takara Cat# R001A Takara Ex Taq Takara Cat# RR001A Agarose for ≧1kbp fragment (Fine Powder) Nacalai Tesque Cat# 02468-95 100 bp DNA ladder One Nacalai Tesque Cat# 07908-75 6x Loading Dye Toyobo Cat# RE-DYE Ethidium Bromide Solution Nacalai Tesque Cat# 14631-94 Sodium Chloride Nacalai Tesque Cat# 31320-05 Bacto TM Peptone DIFCO Cat# 0118-17-0 Extract Yeast Dried Nacalai Tesque Cat# 15838-45 Bacto TM Agar BD Cat# 214010 Competent Quick DH5α Toyobo Cat# DNA-913 Ampicillin Sodium Salt Nacalai Tesque Cat# 02739-74 KOD-Plus-Neo Toyobo Cat# KOD-401 QIAGEN Plasmid Midi kit QIAGEN Cat# 12145 Calf intestine alkarine phosphatase Takara Cat# 2250A QIAEX II Gel Extraction Kit QIAGEN Cat# 20021 DNA Ligation Kit Ver.2.1 Takara Cat# 6022 Venoject II Terumo Cat# VP-DK051K Isoflurane Viatris – Domitor Nippon Zenyaku Kogyo – Midazolam Sandoz – Vetorphale Meiji Seika Pharma – Antisedan Nippon Zenyaku Kogyo – Deposited data Metabolomics data (Skeletal muscle, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003721; Project ID: PR002310 Metabolomics data (plasma, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003722; Project ID: PR002311 Metabolomics data (Skeletal muscle, Cancer cachexia and starvation, C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003723; Project ID: PR002312 Metabolomics data (Skeletal muscle, immobilization, mFoxO1,3,4 flox/flox and mFoxO1,3,4 − /− ) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003724; Project ID: PR002313 Experimental models: Cell lines LLC cells: LL/2 (LLC1) ATCC CRL-1642 Primary myoblast This paper N/A C2C12 myoblasts Riken Cell Bank RCB0987 C2C12 myoblasts (Western blot analysis for SUnSET analysis and MG-132 experiment) ATCC CRL-1772 HEK293T cells Oyabu et al. 29 N/A Experimental models: Organisms/strains Mouse: C57BL/6J CLEA – Mouse: HSA-FOXO1-Tg Kamei Lab N/A Mouse: HSA-Cre FoxO1,3,4 flox/flox Kamei Lab N/A Mouse: HSA-DN-FOXO1-Tg Yamazaki et al. 42 N/A (Continued on next page) Cell Reports 44, 116097, August 26, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primers for genotyping This paper Table S1 Primer for RT-qPCR This paper Table S2 MISSION siRNA Universal Negative Control #1 Sigma-Aldrich Cat# SIC001 MISSION siAmd2_1 Sigma-Aldrich Cat# SASI_Mm02_00311615 MISSION siAmd2_2 Sigma-Aldrich Cat# SASI_Mm01_00156378 Recombinant DNA pCAG-FOXO1(3A) Oyabu et al. 29 N/A pCMX-GFP Oyabu et al. 29 N/A pGL3-Odc1 promoter-luciferase This paper N/A phRL-TK Promega Cat# E2241 Software and Article Title: Alternative mRNA splicing events and regulators in epidermal differentiation. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Halt Protease and Phosphatase Inhibitor Cocktail Thermo Scientific Cat# 78440 Lipofectamine RNAiMAX Transfection Reagent Invitrogen Cat# 13778030 Attractene Transfection Reagent Qiagen Cat# 301005 Agarose Fisher BioReagent Cat# BP160-500 Human TNFa Recombinant Protein Fisher Scientific Cat# 210-TA-005 alamarBlue Cell Viability Reagent Invitrogen Cat# DAL1025 Tissue-Tek O.C.T. .. Compound Sakura Cat# 4583 Prostratin, PKC activator abcam Cat# ab120880 Critical commercial assays RNeasy Plus Mini Kit Qiagen Cat# 74136 iScript Reverse Transcription Supermix for RT-qPCR Bio-Rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-Rad Cat# 1725124 Nuclear Extract Kit Active Motif Cat# 40010 TransAM NF-kB p65 Transcription Factor ELISA Kit Active Motif Cat# 40097 Deposited data RNA-seq data This paper GEO: GSE201094 Experimental models: Cell lines Human primary keratinocytes This Paper N/A Experimental models: Organisms/strains Human Dermis New York Firefighters Skin Bank N/A Oligonucleotides DsiRNA (MAP3K7 long) Forward Integrated DNA Technologies 50- CGUAAAACUGCUUCAUUUGGC AACA-30 DsiRNA (MAP3K7 long) Reverse Integrated DNA Technologies 50- UGGCAUUUUGACGAAGUAAAC CGUUGU-30 DsiRNA (MAP3K7 short) Forward Integrated DNA Technologies 50- CAAAGCAACAGAGUGAAUCUG GACGUU-30 DsiRNA (MAP3K7 short) Reverse Integrated DNA Technologies 50- GUUUCGUUGUCUCACUUAGAC CUGCAA-30 FUS siRNA-1 Thermo Fisher S5401 FUS siRNA-2 Thermo Fisher S533595 siRNA (negative control) Thermo Fisher Cat# 4390843 Primers for RT-PCR and qRT-PCR, see Table S6 This paper N/A Recombinant DNA pcDNA3.1-C-(k)DYK-MAP3K7 long Genescript Cat# OHu21832 pcDNA3.1-C-(k)DYK-MAP3K7 short Genescript Cat# OHu14588 Software and algorithms Prism 9 GraphPad software www.graphpad.com Article Title: NCOA1 is a gatekeeper of the sexually dimorphic thermogenic activity of white adipose tissue Article Snippet: Saturated membranes were incubated overnight with a 1:1000 dilution of a total OXPHOS human western blot antibody cocktail (Abcam, ab110413; RRID:AB_2629281) followed by incubation with HRP-conjugated anti-mouse immunoglobulins for 60 min. .. The chemiluminescence obtained after the addition of Clarity Western ECL substrate (Bio-Rad, Marnes-la-Coquette, France) was detected using a ChemiDoc MP imaging system (Bio-Rad) and quantified using Negative Control:Article Title: Multi-dimensional metabolomic remodeling under diverse muscle atrophic stimuli in vivo. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER TSKgel Amide-80 (3.0 μm, 2.0 mm × 15 cm TOSOH Corporation Cat# 0021865 G266 DNA Damage Detection Kit - γH2AX - Red Dojindo Molecular Technologies Cat# 340-09431 HEPES Nacalai Tesque Cat# 02443-34 Trichloroacetic acid Nacalai Tesque Cat# 06275-24 L-Methionine sulfome Thermo Fisher Cat# A17027 Takara Taq Takara Cat# R001A Takara Ex Taq Takara Cat# RR001A Agarose for ≧1kbp fragment (Fine Powder) Nacalai Tesque Cat# 02468-95 100 bp DNA ladder One Nacalai Tesque Cat# 07908-75 6x Loading Dye Toyobo Cat# RE-DYE Ethidium Bromide Solution Nacalai Tesque Cat# 14631-94 Sodium Chloride Nacalai Tesque Cat# 31320-05 Bacto TM Peptone DIFCO Cat# 0118-17-0 Extract Yeast Dried Nacalai Tesque Cat# 15838-45 Bacto TM Agar BD Cat# 214010 Competent Quick DH5α Toyobo Cat# DNA-913 Ampicillin Sodium Salt Nacalai Tesque Cat# 02739-74 KOD-Plus-Neo Toyobo Cat# KOD-401 QIAGEN Plasmid Midi kit QIAGEN Cat# 12145 Calf intestine alkarine phosphatase Takara Cat# 2250A QIAEX II Gel Extraction Kit QIAGEN Cat# 20021 DNA Ligation Kit Ver.2.1 Takara Cat# 6022 Venoject II Terumo Cat# VP-DK051K Isoflurane Viatris – Domitor Nippon Zenyaku Kogyo – Midazolam Sandoz – Vetorphale Meiji Seika Pharma – Antisedan Nippon Zenyaku Kogyo – Deposited data Metabolomics data (Skeletal muscle, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003721; Project ID: PR002310 Metabolomics data (plasma, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003722; Project ID: PR002311 Metabolomics data (Skeletal muscle, Cancer cachexia and starvation, C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003723; Project ID: PR002312 Metabolomics data (Skeletal muscle, immobilization, mFoxO1,3,4 flox/flox and mFoxO1,3,4 − /− ) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003724; Project ID: PR002313 Experimental models: Cell lines LLC cells: LL/2 (LLC1) ATCC CRL-1642 Primary myoblast This paper N/A C2C12 myoblasts Riken Cell Bank RCB0987 C2C12 myoblasts (Western blot analysis for SUnSET analysis and MG-132 experiment) ATCC CRL-1772 HEK293T cells Oyabu et al. 29 N/A Experimental models: Organisms/strains Mouse: C57BL/6J CLEA – Mouse: HSA-FOXO1-Tg Kamei Lab N/A Mouse: HSA-Cre FoxO1,3,4 flox/flox Kamei Lab N/A Mouse: HSA-DN-FOXO1-Tg Yamazaki et al. 42 N/A (Continued on next page) Cell Reports 44, 116097, August 26, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primers for genotyping This paper Table S1 Primer for RT-qPCR This paper Table S2 MISSION siRNA Universal Negative Control #1 Sigma-Aldrich Cat# SIC001 MISSION siAmd2_1 Sigma-Aldrich Cat# SASI_Mm02_00311615 MISSION siAmd2_2 Sigma-Aldrich Cat# SASI_Mm01_00156378 Recombinant DNA pCAG-FOXO1(3A) Oyabu et al. 29 N/A pCMX-GFP Oyabu et al. 29 N/A pGL3-Odc1 promoter-luciferase This paper N/A phRL-TK Promega Cat# E2241 Software and Article Title: Alternative mRNA splicing events and regulators in epidermal differentiation. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Halt Protease and Phosphatase Inhibitor Cocktail Thermo Scientific Cat# 78440 Lipofectamine RNAiMAX Transfection Reagent Invitrogen Cat# 13778030 Attractene Transfection Reagent Qiagen Cat# 301005 Agarose Fisher BioReagent Cat# BP160-500 Human TNFa Recombinant Protein Fisher Scientific Cat# 210-TA-005 alamarBlue Cell Viability Reagent Invitrogen Cat# DAL1025 Tissue-Tek O.C.T. .. Compound Sakura Cat# 4583 Prostratin, PKC activator abcam Cat# ab120880 Critical commercial assays RNeasy Plus Mini Kit Qiagen Cat# 74136 iScript Reverse Transcription Supermix for RT-qPCR Bio-Rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-Rad Cat# 1725124 Nuclear Extract Kit Active Motif Cat# 40010 TransAM NF-kB p65 Transcription Factor ELISA Kit Active Motif Cat# 40097 Deposited data RNA-seq data This paper GEO: GSE201094 Experimental models: Cell lines Human primary keratinocytes This Paper N/A Experimental models: Organisms/strains Human Dermis New York Firefighters Skin Bank N/A Oligonucleotides DsiRNA (MAP3K7 long) Forward Integrated DNA Technologies 50- CGUAAAACUGCUUCAUUUGGC AACA-30 DsiRNA (MAP3K7 long) Reverse Integrated DNA Technologies 50- UGGCAUUUUGACGAAGUAAAC CGUUGU-30 DsiRNA (MAP3K7 short) Forward Integrated DNA Technologies 50- CAAAGCAACAGAGUGAAUCUG GACGUU-30 DsiRNA (MAP3K7 short) Reverse Integrated DNA Technologies 50- GUUUCGUUGUCUCACUUAGAC CUGCAA-30 FUS siRNA-1 Thermo Fisher S5401 FUS siRNA-2 Thermo Fisher S533595 siRNA (negative control) Thermo Fisher Cat# 4390843 Primers for RT-PCR and qRT-PCR, see Table S6 This paper N/A Recombinant DNA pcDNA3.1-C-(k)DYK-MAP3K7 long Genescript Cat# OHu21832 pcDNA3.1-C-(k)DYK-MAP3K7 short Genescript Cat# OHu14588 Software and algorithms Prism 9 GraphPad software www.graphpad.com Liquid Chromatography with Mass Spectroscopy:Article Title: Multi-dimensional metabolomic remodeling under diverse muscle atrophic stimuli in vivo. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER TSKgel Amide-80 (3.0 μm, 2.0 mm × 15 cm TOSOH Corporation Cat# 0021865 G266 DNA Damage Detection Kit - γH2AX - Red Dojindo Molecular Technologies Cat# 340-09431 HEPES Nacalai Tesque Cat# 02443-34 Trichloroacetic acid Nacalai Tesque Cat# 06275-24 L-Methionine sulfome Thermo Fisher Cat# A17027 Takara Taq Takara Cat# R001A Takara Ex Taq Takara Cat# RR001A Agarose for ≧1kbp fragment (Fine Powder) Nacalai Tesque Cat# 02468-95 100 bp DNA ladder One Nacalai Tesque Cat# 07908-75 6x Loading Dye Toyobo Cat# RE-DYE Ethidium Bromide Solution Nacalai Tesque Cat# 14631-94 Sodium Chloride Nacalai Tesque Cat# 31320-05 Bacto TM Peptone DIFCO Cat# 0118-17-0 Extract Yeast Dried Nacalai Tesque Cat# 15838-45 Bacto TM Agar BD Cat# 214010 Competent Quick DH5α Toyobo Cat# DNA-913 Ampicillin Sodium Salt Nacalai Tesque Cat# 02739-74 KOD-Plus-Neo Toyobo Cat# KOD-401 QIAGEN Plasmid Midi kit QIAGEN Cat# 12145 Calf intestine alkarine phosphatase Takara Cat# 2250A QIAEX II Gel Extraction Kit QIAGEN Cat# 20021 DNA Ligation Kit Ver.2.1 Takara Cat# 6022 Venoject II Terumo Cat# VP-DK051K Isoflurane Viatris – Domitor Nippon Zenyaku Kogyo – Midazolam Sandoz – Vetorphale Meiji Seika Pharma – Antisedan Nippon Zenyaku Kogyo – Deposited data Metabolomics data (Skeletal muscle, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003721; Project ID: PR002310 Metabolomics data (plasma, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003722; Project ID: PR002311 Metabolomics data (Skeletal muscle, Cancer cachexia and starvation, C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003723; Project ID: PR002312 Metabolomics data (Skeletal muscle, immobilization, mFoxO1,3,4 flox/flox and mFoxO1,3,4 − /− ) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003724; Project ID: PR002313 Experimental models: Cell lines LLC cells: LL/2 (LLC1) ATCC CRL-1642 Primary myoblast This paper N/A C2C12 myoblasts Riken Cell Bank RCB0987 C2C12 myoblasts (Western blot analysis for SUnSET analysis and MG-132 experiment) ATCC CRL-1772 HEK293T cells Oyabu et al. 29 N/A Experimental models: Organisms/strains Mouse: C57BL/6J CLEA – Mouse: HSA-FOXO1-Tg Kamei Lab N/A Mouse: HSA-Cre FoxO1,3,4 flox/flox Kamei Lab N/A Mouse: HSA-DN-FOXO1-Tg Yamazaki et al. 42 N/A (Continued on next page) Cell Reports 44, 116097, August 26, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primers for genotyping This paper Table S1 Primer for RT-qPCR This paper Table S2 MISSION siRNA Universal Negative Control #1 Sigma-Aldrich Cat# SIC001 MISSION siAmd2_1 Sigma-Aldrich Cat# SASI_Mm02_00311615 MISSION siAmd2_2 Sigma-Aldrich Cat# SASI_Mm01_00156378 Recombinant DNA pCAG-FOXO1(3A) Oyabu et al. 29 N/A pCMX-GFP Oyabu et al. 29 N/A pGL3-Odc1 promoter-luciferase This paper N/A phRL-TK Promega Cat# E2241 Software and RNA Sequencing:Article Title: Multi-dimensional metabolomic remodeling under diverse muscle atrophic stimuli in vivo. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER TSKgel Amide-80 (3.0 μm, 2.0 mm × 15 cm TOSOH Corporation Cat# 0021865 G266 DNA Damage Detection Kit - γH2AX - Red Dojindo Molecular Technologies Cat# 340-09431 HEPES Nacalai Tesque Cat# 02443-34 Trichloroacetic acid Nacalai Tesque Cat# 06275-24 L-Methionine sulfome Thermo Fisher Cat# A17027 Takara Taq Takara Cat# R001A Takara Ex Taq Takara Cat# RR001A Agarose for ≧1kbp fragment (Fine Powder) Nacalai Tesque Cat# 02468-95 100 bp DNA ladder One Nacalai Tesque Cat# 07908-75 6x Loading Dye Toyobo Cat# RE-DYE Ethidium Bromide Solution Nacalai Tesque Cat# 14631-94 Sodium Chloride Nacalai Tesque Cat# 31320-05 Bacto TM Peptone DIFCO Cat# 0118-17-0 Extract Yeast Dried Nacalai Tesque Cat# 15838-45 Bacto TM Agar BD Cat# 214010 Competent Quick DH5α Toyobo Cat# DNA-913 Ampicillin Sodium Salt Nacalai Tesque Cat# 02739-74 KOD-Plus-Neo Toyobo Cat# KOD-401 QIAGEN Plasmid Midi kit QIAGEN Cat# 12145 Calf intestine alkarine phosphatase Takara Cat# 2250A QIAEX II Gel Extraction Kit QIAGEN Cat# 20021 DNA Ligation Kit Ver.2.1 Takara Cat# 6022 Venoject II Terumo Cat# VP-DK051K Isoflurane Viatris – Domitor Nippon Zenyaku Kogyo – Midazolam Sandoz – Vetorphale Meiji Seika Pharma – Antisedan Nippon Zenyaku Kogyo – Deposited data Metabolomics data (Skeletal muscle, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003721; Project ID: PR002310 Metabolomics data (plasma, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003722; Project ID: PR002311 Metabolomics data (Skeletal muscle, Cancer cachexia and starvation, C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003723; Project ID: PR002312 Metabolomics data (Skeletal muscle, immobilization, mFoxO1,3,4 flox/flox and mFoxO1,3,4 − /− ) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003724; Project ID: PR002313 Experimental models: Cell lines LLC cells: LL/2 (LLC1) ATCC CRL-1642 Primary myoblast This paper N/A C2C12 myoblasts Riken Cell Bank RCB0987 C2C12 myoblasts (Western blot analysis for SUnSET analysis and MG-132 experiment) ATCC CRL-1772 HEK293T cells Oyabu et al. 29 N/A Experimental models: Organisms/strains Mouse: C57BL/6J CLEA – Mouse: HSA-FOXO1-Tg Kamei Lab N/A Mouse: HSA-Cre FoxO1,3,4 flox/flox Kamei Lab N/A Mouse: HSA-DN-FOXO1-Tg Yamazaki et al. 42 N/A (Continued on next page) Cell Reports 44, 116097, August 26, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primers for genotyping This paper Table S1 Primer for RT-qPCR This paper Table S2 MISSION siRNA Universal Negative Control #1 Sigma-Aldrich Cat# SIC001 MISSION siAmd2_1 Sigma-Aldrich Cat# SASI_Mm02_00311615 MISSION siAmd2_2 Sigma-Aldrich Cat# SASI_Mm01_00156378 Recombinant DNA pCAG-FOXO1(3A) Oyabu et al. 29 N/A pCMX-GFP Oyabu et al. 29 N/A pGL3-Odc1 promoter-luciferase This paper N/A phRL-TK Promega Cat# E2241 Software and Article Title: Alternative mRNA splicing events and regulators in epidermal differentiation. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Halt Protease and Phosphatase Inhibitor Cocktail Thermo Scientific Cat# 78440 Lipofectamine RNAiMAX Transfection Reagent Invitrogen Cat# 13778030 Attractene Transfection Reagent Qiagen Cat# 301005 Agarose Fisher BioReagent Cat# BP160-500 Human TNFa Recombinant Protein Fisher Scientific Cat# 210-TA-005 alamarBlue Cell Viability Reagent Invitrogen Cat# DAL1025 Tissue-Tek O.C.T. .. Compound Sakura Cat# 4583 Prostratin, PKC activator abcam Cat# ab120880 Critical commercial assays RNeasy Plus Mini Kit Qiagen Cat# 74136 iScript Reverse Transcription Supermix for RT-qPCR Bio-Rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-Rad Cat# 1725124 Nuclear Extract Kit Active Motif Cat# 40010 TransAM NF-kB p65 Transcription Factor ELISA Kit Active Motif Cat# 40097 Deposited data RNA-seq data This paper GEO: GSE201094 Experimental models: Cell lines Human primary keratinocytes This Paper N/A Experimental models: Organisms/strains Human Dermis New York Firefighters Skin Bank N/A Oligonucleotides DsiRNA (MAP3K7 long) Forward Integrated DNA Technologies 50- CGUAAAACUGCUUCAUUUGGC AACA-30 DsiRNA (MAP3K7 long) Reverse Integrated DNA Technologies 50- UGGCAUUUUGACGAAGUAAAC CGUUGU-30 DsiRNA (MAP3K7 short) Forward Integrated DNA Technologies 50- CAAAGCAACAGAGUGAAUCUG GACGUU-30 DsiRNA (MAP3K7 short) Reverse Integrated DNA Technologies 50- GUUUCGUUGUCUCACUUAGAC CUGCAA-30 FUS siRNA-1 Thermo Fisher S5401 FUS siRNA-2 Thermo Fisher S533595 siRNA (negative control) Thermo Fisher Cat# 4390843 Primers for RT-PCR and qRT-PCR, see Table S6 This paper N/A Recombinant DNA pcDNA3.1-C-(k)DYK-MAP3K7 long Genescript Cat# OHu21832 pcDNA3.1-C-(k)DYK-MAP3K7 short Genescript Cat# OHu14588 Software and algorithms Prism 9 GraphPad software www.graphpad.com Sequencing:Article Title: Multi-dimensional metabolomic remodeling under diverse muscle atrophic stimuli in vivo. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER TSKgel Amide-80 (3.0 μm, 2.0 mm × 15 cm TOSOH Corporation Cat# 0021865 G266 DNA Damage Detection Kit - γH2AX - Red Dojindo Molecular Technologies Cat# 340-09431 HEPES Nacalai Tesque Cat# 02443-34 Trichloroacetic acid Nacalai Tesque Cat# 06275-24 L-Methionine sulfome Thermo Fisher Cat# A17027 Takara Taq Takara Cat# R001A Takara Ex Taq Takara Cat# RR001A Agarose for ≧1kbp fragment (Fine Powder) Nacalai Tesque Cat# 02468-95 100 bp DNA ladder One Nacalai Tesque Cat# 07908-75 6x Loading Dye Toyobo Cat# RE-DYE Ethidium Bromide Solution Nacalai Tesque Cat# 14631-94 Sodium Chloride Nacalai Tesque Cat# 31320-05 Bacto TM Peptone DIFCO Cat# 0118-17-0 Extract Yeast Dried Nacalai Tesque Cat# 15838-45 Bacto TM Agar BD Cat# 214010 Competent Quick DH5α Toyobo Cat# DNA-913 Ampicillin Sodium Salt Nacalai Tesque Cat# 02739-74 KOD-Plus-Neo Toyobo Cat# KOD-401 QIAGEN Plasmid Midi kit QIAGEN Cat# 12145 Calf intestine alkarine phosphatase Takara Cat# 2250A QIAEX II Gel Extraction Kit QIAGEN Cat# 20021 DNA Ligation Kit Ver.2.1 Takara Cat# 6022 Venoject II Terumo Cat# VP-DK051K Isoflurane Viatris – Domitor Nippon Zenyaku Kogyo – Midazolam Sandoz – Vetorphale Meiji Seika Pharma – Antisedan Nippon Zenyaku Kogyo – Deposited data Metabolomics data (Skeletal muscle, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003721; Project ID: PR002310 Metabolomics data (plasma, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003722; Project ID: PR002311 Metabolomics data (Skeletal muscle, Cancer cachexia and starvation, C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003723; Project ID: PR002312 Metabolomics data (Skeletal muscle, immobilization, mFoxO1,3,4 flox/flox and mFoxO1,3,4 − /− ) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003724; Project ID: PR002313 Experimental models: Cell lines LLC cells: LL/2 (LLC1) ATCC CRL-1642 Primary myoblast This paper N/A C2C12 myoblasts Riken Cell Bank RCB0987 C2C12 myoblasts (Western blot analysis for SUnSET analysis and MG-132 experiment) ATCC CRL-1772 HEK293T cells Oyabu et al. 29 N/A Experimental models: Organisms/strains Mouse: C57BL/6J CLEA – Mouse: HSA-FOXO1-Tg Kamei Lab N/A Mouse: HSA-Cre FoxO1,3,4 flox/flox Kamei Lab N/A Mouse: HSA-DN-FOXO1-Tg Yamazaki et al. 42 N/A (Continued on next page) Cell Reports 44, 116097, August 26, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primers for genotyping This paper Table S1 Primer for RT-qPCR This paper Table S2 MISSION siRNA Universal Negative Control #1 Sigma-Aldrich Cat# SIC001 MISSION siAmd2_1 Sigma-Aldrich Cat# SASI_Mm02_00311615 MISSION siAmd2_2 Sigma-Aldrich Cat# SASI_Mm01_00156378 Recombinant DNA pCAG-FOXO1(3A) Oyabu et al. 29 N/A pCMX-GFP Oyabu et al. 29 N/A pGL3-Odc1 promoter-luciferase This paper N/A phRL-TK Promega Cat# E2241 Software and Metabolomic:Article Title: Multi-dimensional metabolomic remodeling under diverse muscle atrophic stimuli in vivo. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER TSKgel Amide-80 (3.0 μm, 2.0 mm × 15 cm TOSOH Corporation Cat# 0021865 G266 DNA Damage Detection Kit - γH2AX - Red Dojindo Molecular Technologies Cat# 340-09431 HEPES Nacalai Tesque Cat# 02443-34 Trichloroacetic acid Nacalai Tesque Cat# 06275-24 L-Methionine sulfome Thermo Fisher Cat# A17027 Takara Taq Takara Cat# R001A Takara Ex Taq Takara Cat# RR001A Agarose for ≧1kbp fragment (Fine Powder) Nacalai Tesque Cat# 02468-95 100 bp DNA ladder One Nacalai Tesque Cat# 07908-75 6x Loading Dye Toyobo Cat# RE-DYE Ethidium Bromide Solution Nacalai Tesque Cat# 14631-94 Sodium Chloride Nacalai Tesque Cat# 31320-05 Bacto TM Peptone DIFCO Cat# 0118-17-0 Extract Yeast Dried Nacalai Tesque Cat# 15838-45 Bacto TM Agar BD Cat# 214010 Competent Quick DH5α Toyobo Cat# DNA-913 Ampicillin Sodium Salt Nacalai Tesque Cat# 02739-74 KOD-Plus-Neo Toyobo Cat# KOD-401 QIAGEN Plasmid Midi kit QIAGEN Cat# 12145 Calf intestine alkarine phosphatase Takara Cat# 2250A QIAEX II Gel Extraction Kit QIAGEN Cat# 20021 DNA Ligation Kit Ver.2.1 Takara Cat# 6022 Venoject II Terumo Cat# VP-DK051K Isoflurane Viatris – Domitor Nippon Zenyaku Kogyo – Midazolam Sandoz – Vetorphale Meiji Seika Pharma – Antisedan Nippon Zenyaku Kogyo – Deposited data Metabolomics data (Skeletal muscle, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003721; Project ID: PR002310 Metabolomics data (plasma, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003722; Project ID: PR002311 Metabolomics data (Skeletal muscle, Cancer cachexia and starvation, C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003723; Project ID: PR002312 Metabolomics data (Skeletal muscle, immobilization, mFoxO1,3,4 flox/flox and mFoxO1,3,4 − /− ) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003724; Project ID: PR002313 Experimental models: Cell lines LLC cells: LL/2 (LLC1) ATCC CRL-1642 Primary myoblast This paper N/A C2C12 myoblasts Riken Cell Bank RCB0987 C2C12 myoblasts (Western blot analysis for SUnSET analysis and MG-132 experiment) ATCC CRL-1772 HEK293T cells Oyabu et al. 29 N/A Experimental models: Organisms/strains Mouse: C57BL/6J CLEA – Mouse: HSA-FOXO1-Tg Kamei Lab N/A Mouse: HSA-Cre FoxO1,3,4 flox/flox Kamei Lab N/A Mouse: HSA-DN-FOXO1-Tg Yamazaki et al. 42 N/A (Continued on next page) Cell Reports 44, 116097, August 26, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primers for genotyping This paper Table S1 Primer for RT-qPCR This paper Table S2 MISSION siRNA Universal Negative Control #1 Sigma-Aldrich Cat# SIC001 MISSION siAmd2_1 Sigma-Aldrich Cat# SASI_Mm02_00311615 MISSION siAmd2_2 Sigma-Aldrich Cat# SASI_Mm01_00156378 Recombinant DNA pCAG-FOXO1(3A) Oyabu et al. 29 N/A pCMX-GFP Oyabu et al. 29 N/A pGL3-Odc1 promoter-luciferase This paper N/A phRL-TK Promega Cat# E2241 Software and Targeted Proteomics:Article Title: Multi-dimensional metabolomic remodeling under diverse muscle atrophic stimuli in vivo. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER TSKgel Amide-80 (3.0 μm, 2.0 mm × 15 cm TOSOH Corporation Cat# 0021865 G266 DNA Damage Detection Kit - γH2AX - Red Dojindo Molecular Technologies Cat# 340-09431 HEPES Nacalai Tesque Cat# 02443-34 Trichloroacetic acid Nacalai Tesque Cat# 06275-24 L-Methionine sulfome Thermo Fisher Cat# A17027 Takara Taq Takara Cat# R001A Takara Ex Taq Takara Cat# RR001A Agarose for ≧1kbp fragment (Fine Powder) Nacalai Tesque Cat# 02468-95 100 bp DNA ladder One Nacalai Tesque Cat# 07908-75 6x Loading Dye Toyobo Cat# RE-DYE Ethidium Bromide Solution Nacalai Tesque Cat# 14631-94 Sodium Chloride Nacalai Tesque Cat# 31320-05 Bacto TM Peptone DIFCO Cat# 0118-17-0 Extract Yeast Dried Nacalai Tesque Cat# 15838-45 Bacto TM Agar BD Cat# 214010 Competent Quick DH5α Toyobo Cat# DNA-913 Ampicillin Sodium Salt Nacalai Tesque Cat# 02739-74 KOD-Plus-Neo Toyobo Cat# KOD-401 QIAGEN Plasmid Midi kit QIAGEN Cat# 12145 Calf intestine alkarine phosphatase Takara Cat# 2250A QIAEX II Gel Extraction Kit QIAGEN Cat# 20021 DNA Ligation Kit Ver.2.1 Takara Cat# 6022 Venoject II Terumo Cat# VP-DK051K Isoflurane Viatris – Domitor Nippon Zenyaku Kogyo – Midazolam Sandoz – Vetorphale Meiji Seika Pharma – Antisedan Nippon Zenyaku Kogyo – Deposited data Metabolomics data (Skeletal muscle, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003721; Project ID: PR002310 Metabolomics data (plasma, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003722; Project ID: PR002311 Metabolomics data (Skeletal muscle, Cancer cachexia and starvation, C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003723; Project ID: PR002312 Metabolomics data (Skeletal muscle, immobilization, mFoxO1,3,4 flox/flox and mFoxO1,3,4 − /− ) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003724; Project ID: PR002313 Experimental models: Cell lines LLC cells: LL/2 (LLC1) ATCC CRL-1642 Primary myoblast This paper N/A C2C12 myoblasts Riken Cell Bank RCB0987 C2C12 myoblasts (Western blot analysis for SUnSET analysis and MG-132 experiment) ATCC CRL-1772 HEK293T cells Oyabu et al. 29 N/A Experimental models: Organisms/strains Mouse: C57BL/6J CLEA – Mouse: HSA-FOXO1-Tg Kamei Lab N/A Mouse: HSA-Cre FoxO1,3,4 flox/flox Kamei Lab N/A Mouse: HSA-DN-FOXO1-Tg Yamazaki et al. 42 N/A (Continued on next page) Cell Reports 44, 116097, August 26, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primers for genotyping This paper Table S1 Primer for RT-qPCR This paper Table S2 MISSION siRNA Universal Negative Control #1 Sigma-Aldrich Cat# SIC001 MISSION siAmd2_1 Sigma-Aldrich Cat# SASI_Mm02_00311615 MISSION siAmd2_2 Sigma-Aldrich Cat# SASI_Mm01_00156378 Recombinant DNA pCAG-FOXO1(3A) Oyabu et al. 29 N/A pCMX-GFP Oyabu et al. 29 N/A pGL3-Odc1 promoter-luciferase This paper N/A phRL-TK Promega Cat# E2241 Software and Mass Spectrometry:Article Title: Multi-dimensional metabolomic remodeling under diverse muscle atrophic stimuli in vivo. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER TSKgel Amide-80 (3.0 μm, 2.0 mm × 15 cm TOSOH Corporation Cat# 0021865 G266 DNA Damage Detection Kit - γH2AX - Red Dojindo Molecular Technologies Cat# 340-09431 HEPES Nacalai Tesque Cat# 02443-34 Trichloroacetic acid Nacalai Tesque Cat# 06275-24 L-Methionine sulfome Thermo Fisher Cat# A17027 Takara Taq Takara Cat# R001A Takara Ex Taq Takara Cat# RR001A Agarose for ≧1kbp fragment (Fine Powder) Nacalai Tesque Cat# 02468-95 100 bp DNA ladder One Nacalai Tesque Cat# 07908-75 6x Loading Dye Toyobo Cat# RE-DYE Ethidium Bromide Solution Nacalai Tesque Cat# 14631-94 Sodium Chloride Nacalai Tesque Cat# 31320-05 Bacto TM Peptone DIFCO Cat# 0118-17-0 Extract Yeast Dried Nacalai Tesque Cat# 15838-45 Bacto TM Agar BD Cat# 214010 Competent Quick DH5α Toyobo Cat# DNA-913 Ampicillin Sodium Salt Nacalai Tesque Cat# 02739-74 KOD-Plus-Neo Toyobo Cat# KOD-401 QIAGEN Plasmid Midi kit QIAGEN Cat# 12145 Calf intestine alkarine phosphatase Takara Cat# 2250A QIAEX II Gel Extraction Kit QIAGEN Cat# 20021 DNA Ligation Kit Ver.2.1 Takara Cat# 6022 Venoject II Terumo Cat# VP-DK051K Isoflurane Viatris – Domitor Nippon Zenyaku Kogyo – Midazolam Sandoz – Vetorphale Meiji Seika Pharma – Antisedan Nippon Zenyaku Kogyo – Deposited data Metabolomics data (Skeletal muscle, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003721; Project ID: PR002310 Metabolomics data (plasma, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003722; Project ID: PR002311 Metabolomics data (Skeletal muscle, Cancer cachexia and starvation, C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003723; Project ID: PR002312 Metabolomics data (Skeletal muscle, immobilization, mFoxO1,3,4 flox/flox and mFoxO1,3,4 − /− ) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003724; Project ID: PR002313 Experimental models: Cell lines LLC cells: LL/2 (LLC1) ATCC CRL-1642 Primary myoblast This paper N/A C2C12 myoblasts Riken Cell Bank RCB0987 C2C12 myoblasts (Western blot analysis for SUnSET analysis and MG-132 experiment) ATCC CRL-1772 HEK293T cells Oyabu et al. 29 N/A Experimental models: Organisms/strains Mouse: C57BL/6J CLEA – Mouse: HSA-FOXO1-Tg Kamei Lab N/A Mouse: HSA-Cre FoxO1,3,4 flox/flox Kamei Lab N/A Mouse: HSA-DN-FOXO1-Tg Yamazaki et al. 42 N/A (Continued on next page) Cell Reports 44, 116097, August 26, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primers for genotyping This paper Table S1 Primer for RT-qPCR This paper Table S2 MISSION siRNA Universal Negative Control #1 Sigma-Aldrich Cat# SIC001 MISSION siAmd2_1 Sigma-Aldrich Cat# SASI_Mm02_00311615 MISSION siAmd2_2 Sigma-Aldrich Cat# SASI_Mm01_00156378 Recombinant DNA pCAG-FOXO1(3A) Oyabu et al. 29 N/A pCMX-GFP Oyabu et al. 29 N/A pGL3-Odc1 promoter-luciferase This paper N/A phRL-TK Promega Cat# E2241 Software and Real-time Polymerase Chain Reaction:Article Title: Multi-dimensional metabolomic remodeling under diverse muscle atrophic stimuli in vivo. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER TSKgel Amide-80 (3.0 μm, 2.0 mm × 15 cm TOSOH Corporation Cat# 0021865 G266 DNA Damage Detection Kit - γH2AX - Red Dojindo Molecular Technologies Cat# 340-09431 HEPES Nacalai Tesque Cat# 02443-34 Trichloroacetic acid Nacalai Tesque Cat# 06275-24 L-Methionine sulfome Thermo Fisher Cat# A17027 Takara Taq Takara Cat# R001A Takara Ex Taq Takara Cat# RR001A Agarose for ≧1kbp fragment (Fine Powder) Nacalai Tesque Cat# 02468-95 100 bp DNA ladder One Nacalai Tesque Cat# 07908-75 6x Loading Dye Toyobo Cat# RE-DYE Ethidium Bromide Solution Nacalai Tesque Cat# 14631-94 Sodium Chloride Nacalai Tesque Cat# 31320-05 Bacto TM Peptone DIFCO Cat# 0118-17-0 Extract Yeast Dried Nacalai Tesque Cat# 15838-45 Bacto TM Agar BD Cat# 214010 Competent Quick DH5α Toyobo Cat# DNA-913 Ampicillin Sodium Salt Nacalai Tesque Cat# 02739-74 KOD-Plus-Neo Toyobo Cat# KOD-401 QIAGEN Plasmid Midi kit QIAGEN Cat# 12145 Calf intestine alkarine phosphatase Takara Cat# 2250A QIAEX II Gel Extraction Kit QIAGEN Cat# 20021 DNA Ligation Kit Ver.2.1 Takara Cat# 6022 Venoject II Terumo Cat# VP-DK051K Isoflurane Viatris – Domitor Nippon Zenyaku Kogyo – Midazolam Sandoz – Vetorphale Meiji Seika Pharma – Antisedan Nippon Zenyaku Kogyo – Deposited data Metabolomics data (Skeletal muscle, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003721; Project ID: PR002310 Metabolomics data (plasma, FoxO1 overexpression and immobilization, FoxO1-Tg and C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003722; Project ID: PR002311 Metabolomics data (Skeletal muscle, Cancer cachexia and starvation, C57BL/6J) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003723; Project ID: PR002312 Metabolomics data (Skeletal muscle, immobilization, mFoxO1,3,4 flox/flox and mFoxO1,3,4 − /− ) https://www. metabolomicsworkbench.org Metabolomics Workbench Study ID: ST003724; Project ID: PR002313 Experimental models: Cell lines LLC cells: LL/2 (LLC1) ATCC CRL-1642 Primary myoblast This paper N/A C2C12 myoblasts Riken Cell Bank RCB0987 C2C12 myoblasts (Western blot analysis for SUnSET analysis and MG-132 experiment) ATCC CRL-1772 HEK293T cells Oyabu et al. 29 N/A Experimental models: Organisms/strains Mouse: C57BL/6J CLEA – Mouse: HSA-FOXO1-Tg Kamei Lab N/A Mouse: HSA-Cre FoxO1,3,4 flox/flox Kamei Lab N/A Mouse: HSA-DN-FOXO1-Tg Yamazaki et al. 42 N/A (Continued on next page) Cell Reports 44, 116097, August 26, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primers for genotyping This paper Table S1 Primer for RT-qPCR This paper Table S2 MISSION siRNA Universal Negative Control #1 Sigma-Aldrich Cat# SIC001 MISSION siAmd2_1 Sigma-Aldrich Cat# SASI_Mm02_00311615 MISSION siAmd2_2 Sigma-Aldrich Cat# SASI_Mm01_00156378 Recombinant DNA pCAG-FOXO1(3A) Oyabu et al. 29 N/A pCMX-GFP Oyabu et al. 29 N/A pGL3-Odc1 promoter-luciferase This paper N/A phRL-TK Promega Cat# E2241 Software and Article Title: Alternative mRNA splicing events and regulators in epidermal differentiation. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Halt Protease and Phosphatase Inhibitor Cocktail Thermo Scientific Cat# 78440 Lipofectamine RNAiMAX Transfection Reagent Invitrogen Cat# 13778030 Attractene Transfection Reagent Qiagen Cat# 301005 Agarose Fisher BioReagent Cat# BP160-500 Human TNFa Recombinant Protein Fisher Scientific Cat# 210-TA-005 alamarBlue Cell Viability Reagent Invitrogen Cat# DAL1025 Tissue-Tek O.C.T. .. Compound Sakura Cat# 4583 Prostratin, PKC activator abcam Cat# ab120880 Critical commercial assays RNeasy Plus Mini Kit Qiagen Cat# 74136 iScript Reverse Transcription Supermix for RT-qPCR Bio-Rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-Rad Cat# 1725124 Nuclear Extract Kit Active Motif Cat# 40010 TransAM NF-kB p65 Transcription Factor ELISA Kit Active Motif Cat# 40097 Deposited data RNA-seq data This paper GEO: GSE201094 Experimental models: Cell lines Human primary keratinocytes This Paper N/A Experimental models: Organisms/strains Human Dermis New York Firefighters Skin Bank N/A Oligonucleotides DsiRNA (MAP3K7 long) Forward Integrated DNA Technologies 50- CGUAAAACUGCUUCAUUUGGC AACA-30 DsiRNA (MAP3K7 long) Reverse Integrated DNA Technologies 50- UGGCAUUUUGACGAAGUAAAC CGUUGU-30 DsiRNA (MAP3K7 short) Forward Integrated DNA Technologies 50- CAAAGCAACAGAGUGAAUCUG GACGUU-30 DsiRNA (MAP3K7 short) Reverse Integrated DNA Technologies 50- GUUUCGUUGUCUCACUUAGAC CUGCAA-30 FUS siRNA-1 Thermo Fisher S5401 FUS siRNA-2 Thermo Fisher S533595 siRNA (negative control) Thermo Fisher Cat# 4390843 Primers for RT-PCR and qRT-PCR, see Table S6 This paper N/A Recombinant DNA pcDNA3.1-C-(k)DYK-MAP3K7 long Genescript Cat# OHu21832 pcDNA3.1-C-(k)DYK-MAP3K7 short Genescript Cat# OHu14588 Software and algorithms Prism 9 GraphPad software www.graphpad.com Reverse Transcription:Article Title: Alternative mRNA splicing events and regulators in epidermal differentiation. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Halt Protease and Phosphatase Inhibitor Cocktail Thermo Scientific Cat# 78440 Lipofectamine RNAiMAX Transfection Reagent Invitrogen Cat# 13778030 Attractene Transfection Reagent Qiagen Cat# 301005 Agarose Fisher BioReagent Cat# BP160-500 Human TNFa Recombinant Protein Fisher Scientific Cat# 210-TA-005 alamarBlue Cell Viability Reagent Invitrogen Cat# DAL1025 Tissue-Tek O.C.T. .. Compound Sakura Cat# 4583 Prostratin, PKC activator abcam Cat# ab120880 Critical commercial assays RNeasy Plus Mini Kit Qiagen Cat# 74136 iScript Reverse Transcription Supermix for RT-qPCR Bio-Rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-Rad Cat# 1725124 Nuclear Extract Kit Active Motif Cat# 40010 TransAM NF-kB p65 Transcription Factor ELISA Kit Active Motif Cat# 40097 Deposited data RNA-seq data This paper GEO: GSE201094 Experimental models: Cell lines Human primary keratinocytes This Paper N/A Experimental models: Organisms/strains Human Dermis New York Firefighters Skin Bank N/A Oligonucleotides DsiRNA (MAP3K7 long) Forward Integrated DNA Technologies 50- CGUAAAACUGCUUCAUUUGGC AACA-30 DsiRNA (MAP3K7 long) Reverse Integrated DNA Technologies 50- UGGCAUUUUGACGAAGUAAAC CGUUGU-30 DsiRNA (MAP3K7 short) Forward Integrated DNA Technologies 50- CAAAGCAACAGAGUGAAUCUG GACGUU-30 DsiRNA (MAP3K7 short) Reverse Integrated DNA Technologies 50- GUUUCGUUGUCUCACUUAGAC CUGCAA-30 FUS siRNA-1 Thermo Fisher S5401 FUS siRNA-2 Thermo Fisher S533595 siRNA (negative control) Thermo Fisher Cat# 4390843 Primers for RT-PCR and qRT-PCR, see Table S6 This paper N/A Recombinant DNA pcDNA3.1-C-(k)DYK-MAP3K7 long Genescript Cat# OHu21832 pcDNA3.1-C-(k)DYK-MAP3K7 short Genescript Cat# OHu14588 Software and algorithms Prism 9 GraphPad software www.graphpad.com SYBR Green Assay:Article Title: Alternative mRNA splicing events and regulators in epidermal differentiation. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Halt Protease and Phosphatase Inhibitor Cocktail Thermo Scientific Cat# 78440 Lipofectamine RNAiMAX Transfection Reagent Invitrogen Cat# 13778030 Attractene Transfection Reagent Qiagen Cat# 301005 Agarose Fisher BioReagent Cat# BP160-500 Human TNFa Recombinant Protein Fisher Scientific Cat# 210-TA-005 alamarBlue Cell Viability Reagent Invitrogen Cat# DAL1025 Tissue-Tek O.C.T. .. Compound Sakura Cat# 4583 Prostratin, PKC activator abcam Cat# ab120880 Critical commercial assays RNeasy Plus Mini Kit Qiagen Cat# 74136 iScript Reverse Transcription Supermix for RT-qPCR Bio-Rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-Rad Cat# 1725124 Nuclear Extract Kit Active Motif Cat# 40010 TransAM NF-kB p65 Transcription Factor ELISA Kit Active Motif Cat# 40097 Deposited data RNA-seq data This paper GEO: GSE201094 Experimental models: Cell lines Human primary keratinocytes This Paper N/A Experimental models: Organisms/strains Human Dermis New York Firefighters Skin Bank N/A Oligonucleotides DsiRNA (MAP3K7 long) Forward Integrated DNA Technologies 50- CGUAAAACUGCUUCAUUUGGC AACA-30 DsiRNA (MAP3K7 long) Reverse Integrated DNA Technologies 50- UGGCAUUUUGACGAAGUAAAC CGUUGU-30 DsiRNA (MAP3K7 short) Forward Integrated DNA Technologies 50- CAAAGCAACAGAGUGAAUCUG GACGUU-30 DsiRNA (MAP3K7 short) Reverse Integrated DNA Technologies 50- GUUUCGUUGUCUCACUUAGAC CUGCAA-30 FUS siRNA-1 Thermo Fisher S5401 FUS siRNA-2 Thermo Fisher S533595 siRNA (negative control) Thermo Fisher Cat# 4390843 Primers for RT-PCR and qRT-PCR, see Table S6 This paper N/A Recombinant DNA pcDNA3.1-C-(k)DYK-MAP3K7 long Genescript Cat# OHu21832 pcDNA3.1-C-(k)DYK-MAP3K7 short Genescript Cat# OHu14588 Software and algorithms Prism 9 GraphPad software www.graphpad.com Enzyme-linked Immunosorbent Assay:Article Title: Alternative mRNA splicing events and regulators in epidermal differentiation. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Halt Protease and Phosphatase Inhibitor Cocktail Thermo Scientific Cat# 78440 Lipofectamine RNAiMAX Transfection Reagent Invitrogen Cat# 13778030 Attractene Transfection Reagent Qiagen Cat# 301005 Agarose Fisher BioReagent Cat# BP160-500 Human TNFa Recombinant Protein Fisher Scientific Cat# 210-TA-005 alamarBlue Cell Viability Reagent Invitrogen Cat# DAL1025 Tissue-Tek O.C.T. .. Compound Sakura Cat# 4583 Prostratin, PKC activator abcam Cat# ab120880 Critical commercial assays RNeasy Plus Mini Kit Qiagen Cat# 74136 iScript Reverse Transcription Supermix for RT-qPCR Bio-Rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-Rad Cat# 1725124 Nuclear Extract Kit Active Motif Cat# 40010 TransAM NF-kB p65 Transcription Factor ELISA Kit Active Motif Cat# 40097 Deposited data RNA-seq data This paper GEO: GSE201094 Experimental models: Cell lines Human primary keratinocytes This Paper N/A Experimental models: Organisms/strains Human Dermis New York Firefighters Skin Bank N/A Oligonucleotides DsiRNA (MAP3K7 long) Forward Integrated DNA Technologies 50- CGUAAAACUGCUUCAUUUGGC AACA-30 DsiRNA (MAP3K7 long) Reverse Integrated DNA Technologies 50- UGGCAUUUUGACGAAGUAAAC CGUUGU-30 DsiRNA (MAP3K7 short) Forward Integrated DNA Technologies 50- CAAAGCAACAGAGUGAAUCUG GACGUU-30 DsiRNA (MAP3K7 short) Reverse Integrated DNA Technologies 50- GUUUCGUUGUCUCACUUAGAC CUGCAA-30 FUS siRNA-1 Thermo Fisher S5401 FUS siRNA-2 Thermo Fisher S533595 siRNA (negative control) Thermo Fisher Cat# 4390843 Primers for RT-PCR and qRT-PCR, see Table S6 This paper N/A Recombinant DNA pcDNA3.1-C-(k)DYK-MAP3K7 long Genescript Cat# OHu21832 pcDNA3.1-C-(k)DYK-MAP3K7 short Genescript Cat# OHu14588 Software and algorithms Prism 9 GraphPad software www.graphpad.com Reverse Transcription Polymerase Chain Reaction:Article Title: Alternative mRNA splicing events and regulators in epidermal differentiation. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Halt Protease and Phosphatase Inhibitor Cocktail Thermo Scientific Cat# 78440 Lipofectamine RNAiMAX Transfection Reagent Invitrogen Cat# 13778030 Attractene Transfection Reagent Qiagen Cat# 301005 Agarose Fisher BioReagent Cat# BP160-500 Human TNFa Recombinant Protein Fisher Scientific Cat# 210-TA-005 alamarBlue Cell Viability Reagent Invitrogen Cat# DAL1025 Tissue-Tek O.C.T. .. Compound Sakura Cat# 4583 Prostratin, PKC activator abcam Cat# ab120880 Critical commercial assays RNeasy Plus Mini Kit Qiagen Cat# 74136 iScript Reverse Transcription Supermix for RT-qPCR Bio-Rad Cat# 1708841 iTaq Universal SYBR Green Supermix Bio-Rad Cat# 1725124 Nuclear Extract Kit Active Motif Cat# 40010 TransAM NF-kB p65 Transcription Factor ELISA Kit Active Motif Cat# 40097 Deposited data RNA-seq data This paper GEO: GSE201094 Experimental models: Cell lines Human primary keratinocytes This Paper N/A Experimental models: Organisms/strains Human Dermis New York Firefighters Skin Bank N/A Oligonucleotides DsiRNA (MAP3K7 long) Forward Integrated DNA Technologies 50- CGUAAAACUGCUUCAUUUGGC AACA-30 DsiRNA (MAP3K7 long) Reverse Integrated DNA Technologies 50- UGGCAUUUUGACGAAGUAAAC CGUUGU-30 DsiRNA (MAP3K7 short) Forward Integrated DNA Technologies 50- CAAAGCAACAGAGUGAAUCUG GACGUU-30 DsiRNA (MAP3K7 short) Reverse Integrated DNA Technologies 50- GUUUCGUUGUCUCACUUAGAC CUGCAA-30 FUS siRNA-1 Thermo Fisher S5401 FUS siRNA-2 Thermo Fisher S533595 siRNA (negative control) Thermo Fisher Cat# 4390843 Primers for RT-PCR and qRT-PCR, see Table S6 This paper N/A Recombinant DNA pcDNA3.1-C-(k)DYK-MAP3K7 long Genescript Cat# OHu21832 pcDNA3.1-C-(k)DYK-MAP3K7 short Genescript Cat# OHu14588 Software and algorithms Prism 9 GraphPad software www.graphpad.com Western Blot:Article Title: NCOA1 is a gatekeeper of the sexually dimorphic thermogenic activity of white adipose tissue Article Snippet: Saturated membranes were incubated overnight with a 1:1000 dilution of a total OXPHOS human western blot antibody cocktail (Abcam, ab110413; RRID:AB_2629281) followed by incubation with HRP-conjugated anti-mouse immunoglobulins for 60 min. .. The chemiluminescence obtained after the addition of Clarity Western ECL substrate (Bio-Rad, Marnes-la-Coquette, France) was detected using a ChemiDoc MP imaging system (Bio-Rad) and quantified using |